Review



negative control non-specific shrna  (Shanghai GenePharma)

 
  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
    • 90
      Buy from Supplier

    Structured Review

    Shanghai GenePharma negative control non-specific shrna
    Negative Control Non Specific Shrna, supplied by Shanghai GenePharma, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/non-specific+shrna/negative+control+sirna/pm39939672-62-18-25
    Average 90 stars, based on 1 article reviews
    negative control non-specific shrna - by Bioz Stars, 2026-09
    90/100 stars

    Images

    Related Articles

    Transfection:

    Article Title: PAX5-induced upregulation of IDH1-AS1 promotes tumor growth in prostate cancer by regulating ATG5-mediated autophagy
    Article Snippet: To knockdown the expression of PAX5 or IDH1-AS1, the short hairpin RNAs (shRNAs) against PAX5 or IDH1-AS1 (named as shPAX5 or shIDH1-AS1#1/2) and non-specific shRNA (named as shCtrl) were synthesized by GenePharma (Shanghai, China).

    Article Title: In vitro effect of Pannexin 1 channel on the invasion and migration of I-10 testicular cancer cells via ERK1/2 signaling pathway.
    Article Snippet: For gene silencing, I-10 cells were transfected with shRNA targeting mouse Panx-1 gene (shRNA1, 5’-GCATGTATCTACTTGAGCTATTTCAAGAGAATAGCTC AAGTAGATACATGCTT-3’ and shRNA2, 5’-GCATGATTAAGATGGACAT CATTCAAGAGATGATGTCCATCTTAATCATCTT -3’) (Genepharma Co., Ltd, Shanghai, China) while a non-specific shRNA (5’-GTTCTCCGAACG TGTCACGT-3’) (Genepharma Co. Ltd, Shanghai, China) was used as a negative control (NC).

    shRNA:

    Article Title: PAX5-induced upregulation of IDH1-AS1 promotes tumor growth in prostate cancer by regulating ATG5-mediated autophagy
    Article Snippet: To knockdown the expression of PAX5 or IDH1-AS1, the short hairpin RNAs (shRNAs) against PAX5 or IDH1-AS1 (named as shPAX5 or shIDH1-AS1#1/2) and non-specific shRNA (named as shCtrl) were synthesized by GenePharma (Shanghai, China).

    Article Title: In vitro effect of Pannexin 1 channel on the invasion and migration of I-10 testicular cancer cells via ERK1/2 signaling pathway.
    Article Snippet: For gene silencing, I-10 cells were transfected with shRNA targeting mouse Panx-1 gene (shRNA1, 5’-GCATGTATCTACTTGAGCTATTTCAAGAGAATAGCTC AAGTAGATACATGCTT-3’ and shRNA2, 5’-GCATGATTAAGATGGACAT CATTCAAGAGATGATGTCCATCTTAATCATCTT -3’) (Genepharma Co., Ltd, Shanghai, China) while a non-specific shRNA (5’-GTTCTCCGAACG TGTCACGT-3’) (Genepharma Co. Ltd, Shanghai, China) was used as a negative control (NC).

    Negative Control:

    Article Title: PAX5-induced upregulation of IDH1-AS1 promotes tumor growth in prostate cancer by regulating ATG5-mediated autophagy
    Article Snippet: To knockdown the expression of PAX5 or IDH1-AS1, the short hairpin RNAs (shRNAs) against PAX5 or IDH1-AS1 (named as shPAX5 or shIDH1-AS1#1/2) and non-specific shRNA (named as shCtrl) were synthesized by GenePharma (Shanghai, China).

    Article Title: In vitro effect of Pannexin 1 channel on the invasion and migration of I-10 testicular cancer cells via ERK1/2 signaling pathway.
    Article Snippet: For gene silencing, I-10 cells were transfected with shRNA targeting mouse Panx-1 gene (shRNA1, 5’-GCATGTATCTACTTGAGCTATTTCAAGAGAATAGCTC AAGTAGATACATGCTT-3’ and shRNA2, 5’-GCATGATTAAGATGGACAT CATTCAAGAGATGATGTCCATCTTAATCATCTT -3’) (Genepharma Co., Ltd, Shanghai, China) while a non-specific shRNA (5’-GTTCTCCGAACG TGTCACGT-3’) (Genepharma Co. Ltd, Shanghai, China) was used as a negative control (NC).

    Knockdown:

    Article Title: PAX5-induced upregulation of IDH1-AS1 promotes tumor growth in prostate cancer by regulating ATG5-mediated autophagy
    Article Snippet: To knockdown the expression of PAX5 or IDH1-AS1, the short hairpin RNAs (shRNAs) against PAX5 or IDH1-AS1 (named as shPAX5 or shIDH1-AS1#1/2) and non-specific shRNA (named as shCtrl) were synthesized by GenePharma (Shanghai, China).

    Article Title: In vitro effect of Pannexin 1 channel on the invasion and migration of I-10 testicular cancer cells via ERK1/2 signaling pathway.
    Article Snippet: For gene silencing, I-10 cells were transfected with shRNA targeting mouse Panx-1 gene (shRNA1, 5’-GCATGTATCTACTTGAGCTATTTCAAGAGAATAGCTC AAGTAGATACATGCTT-3’ and shRNA2, 5’-GCATGATTAAGATGGACAT CATTCAAGAGATGATGTCCATCTTAATCATCTT -3’) (Genepharma Co., Ltd, Shanghai, China) while a non-specific shRNA (5’-GTTCTCCGAACG TGTCACGT-3’) (Genepharma Co. Ltd, Shanghai, China) was used as a negative control (NC).

    Expressing:

    Article Title: PAX5-induced upregulation of IDH1-AS1 promotes tumor growth in prostate cancer by regulating ATG5-mediated autophagy
    Article Snippet: To knockdown the expression of PAX5 or IDH1-AS1, the short hairpin RNAs (shRNAs) against PAX5 or IDH1-AS1 (named as shPAX5 or shIDH1-AS1#1/2) and non-specific shRNA (named as shCtrl) were synthesized by GenePharma (Shanghai, China).

    Article Title: In vitro effect of Pannexin 1 channel on the invasion and migration of I-10 testicular cancer cells via ERK1/2 signaling pathway.
    Article Snippet: For gene silencing, I-10 cells were transfected with shRNA targeting mouse Panx-1 gene (shRNA1, 5’-GCATGTATCTACTTGAGCTATTTCAAGAGAATAGCTC AAGTAGATACATGCTT-3’ and shRNA2, 5’-GCATGATTAAGATGGACAT CATTCAAGAGATGATGTCCATCTTAATCATCTT -3’) (Genepharma Co., Ltd, Shanghai, China) while a non-specific shRNA (5’-GTTCTCCGAACG TGTCACGT-3’) (Genepharma Co. Ltd, Shanghai, China) was used as a negative control (NC).

    Synthesized:

    Article Title: PAX5-induced upregulation of IDH1-AS1 promotes tumor growth in prostate cancer by regulating ATG5-mediated autophagy
    Article Snippet: To knockdown the expression of PAX5 or IDH1-AS1, the short hairpin RNAs (shRNAs) against PAX5 or IDH1-AS1 (named as shPAX5 or shIDH1-AS1#1/2) and non-specific shRNA (named as shCtrl) were synthesized by GenePharma (Shanghai, China).

    Article Title: In vitro effect of Pannexin 1 channel on the invasion and migration of I-10 testicular cancer cells via ERK1/2 signaling pathway.
    Article Snippet: For gene silencing, I-10 cells were transfected with shRNA targeting mouse Panx-1 gene (shRNA1, 5’-GCATGTATCTACTTGAGCTATTTCAAGAGAATAGCTC AAGTAGATACATGCTT-3’ and shRNA2, 5’-GCATGATTAAGATGGACAT CATTCAAGAGATGATGTCCATCTTAATCATCTT -3’) (Genepharma Co., Ltd, Shanghai, China) while a non-specific shRNA (5’-GTTCTCCGAACG TGTCACGT-3’) (Genepharma Co. Ltd, Shanghai, China) was used as a negative control (NC).

    Microarray:

    Article Title: PAX5-induced upregulation of IDH1-AS1 promotes tumor growth in prostate cancer by regulating ATG5-mediated autophagy
    Article Snippet: To knockdown the expression of PAX5 or IDH1-AS1, the short hairpin RNAs (shRNAs) against PAX5 or IDH1-AS1 (named as shPAX5 or shIDH1-AS1#1/2) and non-specific shRNA (named as shCtrl) were synthesized by GenePharma (Shanghai, China).

    Article Title: In vitro effect of Pannexin 1 channel on the invasion and migration of I-10 testicular cancer cells via ERK1/2 signaling pathway.
    Article Snippet: For gene silencing, I-10 cells were transfected with shRNA targeting mouse Panx-1 gene (shRNA1, 5’-GCATGTATCTACTTGAGCTATTTCAAGAGAATAGCTC AAGTAGATACATGCTT-3’ and shRNA2, 5’-GCATGATTAAGATGGACAT CATTCAAGAGATGATGTCCATCTTAATCATCTT -3’) (Genepharma Co., Ltd, Shanghai, China) while a non-specific shRNA (5’-GTTCTCCGAACG TGTCACGT-3’) (Genepharma Co. Ltd, Shanghai, China) was used as a negative control (NC).

    Control:

    Article Title: PAX5-induced upregulation of IDH1-AS1 promotes tumor growth in prostate cancer by regulating ATG5-mediated autophagy
    Article Snippet: To knockdown the expression of PAX5 or IDH1-AS1, the short hairpin RNAs (shRNAs) against PAX5 or IDH1-AS1 (named as shPAX5 or shIDH1-AS1#1/2) and non-specific shRNA (named as shCtrl) were synthesized by GenePharma (Shanghai, China).

    Article Title: In vitro effect of Pannexin 1 channel on the invasion and migration of I-10 testicular cancer cells via ERK1/2 signaling pathway.
    Article Snippet: For gene silencing, I-10 cells were transfected with shRNA targeting mouse Panx-1 gene (shRNA1, 5’-GCATGTATCTACTTGAGCTATTTCAAGAGAATAGCTC AAGTAGATACATGCTT-3’ and shRNA2, 5’-GCATGATTAAGATGGACAT CATTCAAGAGATGATGTCCATCTTAATCATCTT -3’) (Genepharma Co., Ltd, Shanghai, China) while a non-specific shRNA (5’-GTTCTCCGAACG TGTCACGT-3’) (Genepharma Co. Ltd, Shanghai, China) was used as a negative control (NC).

    Quantitative RT-PCR:

    Article Title: PAX5-induced upregulation of IDH1-AS1 promotes tumor growth in prostate cancer by regulating ATG5-mediated autophagy
    Article Snippet: To knockdown the expression of PAX5 or IDH1-AS1, the short hairpin RNAs (shRNAs) against PAX5 or IDH1-AS1 (named as shPAX5 or shIDH1-AS1#1/2) and non-specific shRNA (named as shCtrl) were synthesized by GenePharma (Shanghai, China).

    Article Title: In vitro effect of Pannexin 1 channel on the invasion and migration of I-10 testicular cancer cells via ERK1/2 signaling pathway.
    Article Snippet: For gene silencing, I-10 cells were transfected with shRNA targeting mouse Panx-1 gene (shRNA1, 5’-GCATGTATCTACTTGAGCTATTTCAAGAGAATAGCTC AAGTAGATACATGCTT-3’ and shRNA2, 5’-GCATGATTAAGATGGACAT CATTCAAGAGATGATGTCCATCTTAATCATCTT -3’) (Genepharma Co., Ltd, Shanghai, China) while a non-specific shRNA (5’-GTTCTCCGAACG TGTCACGT-3’) (Genepharma Co. Ltd, Shanghai, China) was used as a negative control (NC).

    Fluorescence:

    Article Title: PAX5-induced upregulation of IDH1-AS1 promotes tumor growth in prostate cancer by regulating ATG5-mediated autophagy
    Article Snippet: To knockdown the expression of PAX5 or IDH1-AS1, the short hairpin RNAs (shRNAs) against PAX5 or IDH1-AS1 (named as shPAX5 or shIDH1-AS1#1/2) and non-specific shRNA (named as shCtrl) were synthesized by GenePharma (Shanghai, China).

    Article Title: In vitro effect of Pannexin 1 channel on the invasion and migration of I-10 testicular cancer cells via ERK1/2 signaling pathway.
    Article Snippet: For gene silencing, I-10 cells were transfected with shRNA targeting mouse Panx-1 gene (shRNA1, 5’-GCATGTATCTACTTGAGCTATTTCAAGAGAATAGCTC AAGTAGATACATGCTT-3’ and shRNA2, 5’-GCATGATTAAGATGGACAT CATTCAAGAGATGATGTCCATCTTAATCATCTT -3’) (Genepharma Co., Ltd, Shanghai, China) while a non-specific shRNA (5’-GTTCTCCGAACG TGTCACGT-3’) (Genepharma Co. Ltd, Shanghai, China) was used as a negative control (NC).

    Western Blot:

    Article Title: PAX5-induced upregulation of IDH1-AS1 promotes tumor growth in prostate cancer by regulating ATG5-mediated autophagy
    Article Snippet: To knockdown the expression of PAX5 or IDH1-AS1, the short hairpin RNAs (shRNAs) against PAX5 or IDH1-AS1 (named as shPAX5 or shIDH1-AS1#1/2) and non-specific shRNA (named as shCtrl) were synthesized by GenePharma (Shanghai, China).

    Article Title: In vitro effect of Pannexin 1 channel on the invasion and migration of I-10 testicular cancer cells via ERK1/2 signaling pathway.
    Article Snippet: For gene silencing, I-10 cells were transfected with shRNA targeting mouse Panx-1 gene (shRNA1, 5’-GCATGTATCTACTTGAGCTATTTCAAGAGAATAGCTC AAGTAGATACATGCTT-3’ and shRNA2, 5’-GCATGATTAAGATGGACAT CATTCAAGAGATGATGTCCATCTTAATCATCTT -3’) (Genepharma Co., Ltd, Shanghai, China) while a non-specific shRNA (5’-GTTCTCCGAACG TGTCACGT-3’) (Genepharma Co. Ltd, Shanghai, China) was used as a negative control (NC).

    Immunofluorescence:

    Article Title: PAX5-induced upregulation of IDH1-AS1 promotes tumor growth in prostate cancer by regulating ATG5-mediated autophagy
    Article Snippet: To knockdown the expression of PAX5 or IDH1-AS1, the short hairpin RNAs (shRNAs) against PAX5 or IDH1-AS1 (named as shPAX5 or shIDH1-AS1#1/2) and non-specific shRNA (named as shCtrl) were synthesized by GenePharma (Shanghai, China).

    Article Title: In vitro effect of Pannexin 1 channel on the invasion and migration of I-10 testicular cancer cells via ERK1/2 signaling pathway.
    Article Snippet: For gene silencing, I-10 cells were transfected with shRNA targeting mouse Panx-1 gene (shRNA1, 5’-GCATGTATCTACTTGAGCTATTTCAAGAGAATAGCTC AAGTAGATACATGCTT-3’ and shRNA2, 5’-GCATGATTAAGATGGACAT CATTCAAGAGATGATGTCCATCTTAATCATCTT -3’) (Genepharma Co., Ltd, Shanghai, China) while a non-specific shRNA (5’-GTTCTCCGAACG TGTCACGT-3’) (Genepharma Co. Ltd, Shanghai, China) was used as a negative control (NC).

    Staining:

    Article Title: PAX5-induced upregulation of IDH1-AS1 promotes tumor growth in prostate cancer by regulating ATG5-mediated autophagy
    Article Snippet: To knockdown the expression of PAX5 or IDH1-AS1, the short hairpin RNAs (shRNAs) against PAX5 or IDH1-AS1 (named as shPAX5 or shIDH1-AS1#1/2) and non-specific shRNA (named as shCtrl) were synthesized by GenePharma (Shanghai, China).

    Article Title: In vitro effect of Pannexin 1 channel on the invasion and migration of I-10 testicular cancer cells via ERK1/2 signaling pathway.
    Article Snippet: For gene silencing, I-10 cells were transfected with shRNA targeting mouse Panx-1 gene (shRNA1, 5’-GCATGTATCTACTTGAGCTATTTCAAGAGAATAGCTC AAGTAGATACATGCTT-3’ and shRNA2, 5’-GCATGATTAAGATGGACAT CATTCAAGAGATGATGTCCATCTTAATCATCTT -3’) (Genepharma Co., Ltd, Shanghai, China) while a non-specific shRNA (5’-GTTCTCCGAACG TGTCACGT-3’) (Genepharma Co. Ltd, Shanghai, China) was used as a negative control (NC).



    Similar Products

    shrna non-specific controls  (Thermo Fisher)
    90
    Thermo Fisher shrna non-specific controls
    Shrna Non Specific Controls, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/non-specific+shrna/shrna+non+specific+controls/pmc11076954-43-0-9
    Average 90 stars, based on 1 article reviews
    shrna non-specific controls - by Bioz Stars, 2026-09
    90/100 stars
    		  Buy from Supplier
    non specific small interfering rna sirna  (Sangon Biotech)
    86
    Sangon Biotech non specific small interfering rna sirna
    Non Specific Small Interfering Rna Sirna, supplied by Sangon Biotech, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/non-specific+shrna/interfering+rnas+small/pmc12694726-144-0-7
    Average 86 stars, based on 1 article reviews
    non specific small interfering rna sirna - by Bioz Stars, 2026-09
    86/100 stars
    		  Buy from Supplier
    non specific shrna control  (Obio Technology Corp Ltd)
    86
    Obio Technology Corp Ltd non specific shrna control
    M1/M2 polarization in vitro after knockdown of FOSL2 . ( A ) The workflow of M1/M2 polarization in vitro using U937 cells infected by <t>shRNA-</t> FOSL2 -containing lentivirus; ( B ) The comparisons of M1 markers after knockdown of FOSL2 ; Statistical significance was determined by one-way ANOVA, *, p < 0.05; **, p < 0.01; ***, p < 0.001; ns, non-significant. ( C ) The gene set enrichment among shRNA (M0/M1/M2) and control groups, with the red box highlighting the M1 cells without FOSL2 knockdown as the control.
    Non Specific Shrna Control, supplied by Obio Technology Corp Ltd, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/non-specific+shrna/control+non+targeting/pmc12524658-142-12-23
    Average 86 stars, based on 1 article reviews
    non specific shrna control - by Bioz Stars, 2026-09
    86/100 stars
    		  Buy from Supplier
    non specific sirna  (Sangon Biotech)
    86
    Sangon Biotech non specific sirna
    M1/M2 polarization in vitro after knockdown of FOSL2 . ( A ) The workflow of M1/M2 polarization in vitro using U937 cells infected by <t>shRNA-</t> FOSL2 -containing lentivirus; ( B ) The comparisons of M1 markers after knockdown of FOSL2 ; Statistical significance was determined by one-way ANOVA, *, p < 0.05; **, p < 0.01; ***, p < 0.001; ns, non-significant. ( C ) The gene set enrichment among shRNA (M0/M1/M2) and control groups, with the red box highlighting the M1 cells without FOSL2 knockdown as the control.
    Non Specific Sirna, supplied by Sangon Biotech, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/non-specific+shrna/sirna/pm41038399-97-36-28
    Average 86 stars, based on 1 article reviews
    non specific sirna - by Bioz Stars, 2026-09
    86/100 stars
    		  Buy from Supplier
    non-specific shrna lentivirus  (Genechem)
    90
    Genechem non-specific shrna lentivirus
    M1/M2 polarization in vitro after knockdown of FOSL2 . ( A ) The workflow of M1/M2 polarization in vitro using U937 cells infected by <t>shRNA-</t> FOSL2 -containing lentivirus; ( B ) The comparisons of M1 markers after knockdown of FOSL2 ; Statistical significance was determined by one-way ANOVA, *, p < 0.05; **, p < 0.01; ***, p < 0.001; ns, non-significant. ( C ) The gene set enrichment among shRNA (M0/M1/M2) and control groups, with the red box highlighting the M1 cells without FOSL2 knockdown as the control.
    Non Specific Shrna Lentivirus, supplied by Genechem, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/non-specific+shrna/shrna+lentivirus/pmc11863911-49-10-14
    Average 90 stars, based on 1 article reviews
    non-specific shrna lentivirus - by Bioz Stars, 2026-09
    90/100 stars
    		  Buy from Supplier
    negative control non-specific shrna  (Shanghai GenePharma)
    90
    Shanghai GenePharma negative control non-specific shrna
    M1/M2 polarization in vitro after knockdown of FOSL2 . ( A ) The workflow of M1/M2 polarization in vitro using U937 cells infected by <t>shRNA-</t> FOSL2 -containing lentivirus; ( B ) The comparisons of M1 markers after knockdown of FOSL2 ; Statistical significance was determined by one-way ANOVA, *, p < 0.05; **, p < 0.01; ***, p < 0.001; ns, non-significant. ( C ) The gene set enrichment among shRNA (M0/M1/M2) and control groups, with the red box highlighting the M1 cells without FOSL2 knockdown as the control.
    Negative Control Non Specific Shrna, supplied by Shanghai GenePharma, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/non-specific+shrna/negative+control+sirna/pm39939672-62-18-25
    Average 90 stars, based on 1 article reviews
    negative control non-specific shrna - by Bioz Stars, 2026-09
    90/100 stars
    		  Buy from Supplier
    non-specific control shrna  (Genechem)
    90
    Genechem non-specific control shrna
    M1/M2 polarization in vitro after knockdown of FOSL2 . ( A ) The workflow of M1/M2 polarization in vitro using U937 cells infected by <t>shRNA-</t> FOSL2 -containing lentivirus; ( B ) The comparisons of M1 markers after knockdown of FOSL2 ; Statistical significance was determined by one-way ANOVA, *, p < 0.05; **, p < 0.01; ***, p < 0.001; ns, non-significant. ( C ) The gene set enrichment among shRNA (M0/M1/M2) and control groups, with the red box highlighting the M1 cells without FOSL2 knockdown as the control.
    Non Specific Control Shrna, supplied by Genechem, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/non-specific+shrna/nonspecific+control+sirna/pm38702629-59-25-31
    Average 90 stars, based on 1 article reviews
    non-specific control shrna - by Bioz Stars, 2026-09
    90/100 stars
    		  Buy from Supplier
    non-specific shrna control (con-sh  (Millipore)
    90
    Millipore non-specific shrna control (con-sh
    PLCβ4 knockdown reduces RANKL-mediated osteoclast differentiation. BMMs were transduced with non-specific control <t>shRNA</t> (Con-sh) or PLCβ4 shRNA <t>(PLCβ4-sh)</t> <t>lentiviral</t> particles. a The expression of PLCβ4 was analyzed by real-time PCR in BMMs (day 0) or preosteoclasts (day 2). b , c , d Transduced BMMs were cultured with M-CSF (30 ng/mL) and the indicated doses of RANKL for 4 or 5 days. b Osteoclasts were visualized after tartrate-resistant acid phosphatase (TRAP) staining and, c the number of osteoclasts was counted. d TRAP activity was determined by using the cultured cell supernatant generated in ( b) . e Transduced BMMs were cultured in the presence of various concentrations of M-CSF. After 3 days, the MTS assay was performed, as described in the Materials and Methods section. f Transduced BMMs were cultured in osteoclastogenic media for the indicated times. Real-time PCR was performed to assess the gene expression of osteoclastogenic markers. All data are expressed as the mean ± SD. * P < 0.05 and ** P < 0.001 vs. the control (Con-sh)
    Non Specific Shrna Control (Con Sh, supplied by Millipore, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/non-specific+shrna/non+specific+shrna+control++con+sh/bio_rxiv__2024__03__19__585823-185-11-18
    Average 90 stars, based on 1 article reviews
    non-specific shrna control (con-sh - by Bioz Stars, 2026-09
    90/100 stars
    		  Buy from Supplier

    Image Search Results


    M1/M2 polarization in vitro after knockdown of FOSL2 . ( A ) The workflow of M1/M2 polarization in vitro using U937 cells infected by shRNA- FOSL2 -containing lentivirus; ( B ) The comparisons of M1 markers after knockdown of FOSL2 ; Statistical significance was determined by one-way ANOVA, *, p < 0.05; **, p < 0.01; ***, p < 0.001; ns, non-significant. ( C ) The gene set enrichment among shRNA (M0/M1/M2) and control groups, with the red box highlighting the M1 cells without FOSL2 knockdown as the control.

    Journal: International Journal of Molecular Sciences

    Article Title: Synovial CXCL3 + FOSL2 + Macrophages Mediate Inflammation via FOSL2 /AP-1 in Rheumatoid Arthritis: A Single-Cell Transcriptome Analysis

    doi: 10.3390/ijms26199718

    Figure Lengend Snippet: M1/M2 polarization in vitro after knockdown of FOSL2 . ( A ) The workflow of M1/M2 polarization in vitro using U937 cells infected by shRNA- FOSL2 -containing lentivirus; ( B ) The comparisons of M1 markers after knockdown of FOSL2 ; Statistical significance was determined by one-way ANOVA, *, p < 0.05; **, p < 0.01; ***, p < 0.001; ns, non-significant. ( C ) The gene set enrichment among shRNA (M0/M1/M2) and control groups, with the red box highlighting the M1 cells without FOSL2 knockdown as the control.

    Article Snippet: Briefly, lentiviral vectors carrying shRNA targeting FOSL2 (targeted sequencing, 5′-GCAGTGAGTATTGGAAGACTT-3′) and a non-specific shRNA control (target sequencing, 5′-CCTAAGGTTAAGTCGCCCTCG-3′) were constructed and provided by OBiO Technology (Shanghai, China).

    Techniques: In Vitro, Knockdown, Infection, shRNA, Control

    PLCβ4 knockdown reduces RANKL-mediated osteoclast differentiation. BMMs were transduced with non-specific control shRNA (Con-sh) or PLCβ4 shRNA (PLCβ4-sh) lentiviral particles. a The expression of PLCβ4 was analyzed by real-time PCR in BMMs (day 0) or preosteoclasts (day 2). b , c , d Transduced BMMs were cultured with M-CSF (30 ng/mL) and the indicated doses of RANKL for 4 or 5 days. b Osteoclasts were visualized after tartrate-resistant acid phosphatase (TRAP) staining and, c the number of osteoclasts was counted. d TRAP activity was determined by using the cultured cell supernatant generated in ( b) . e Transduced BMMs were cultured in the presence of various concentrations of M-CSF. After 3 days, the MTS assay was performed, as described in the Materials and Methods section. f Transduced BMMs were cultured in osteoclastogenic media for the indicated times. Real-time PCR was performed to assess the gene expression of osteoclastogenic markers. All data are expressed as the mean ± SD. * P < 0.05 and ** P < 0.001 vs. the control (Con-sh)

    Journal: bioRxiv

    Article Title: Phospholipase C β4 promotes RANKL-dependent osteoclastogenesis by interacting with MKK3 and p38 MAPK

    doi: 10.1101/2024.03.19.585823

    Figure Lengend Snippet: PLCβ4 knockdown reduces RANKL-mediated osteoclast differentiation. BMMs were transduced with non-specific control shRNA (Con-sh) or PLCβ4 shRNA (PLCβ4-sh) lentiviral particles. a The expression of PLCβ4 was analyzed by real-time PCR in BMMs (day 0) or preosteoclasts (day 2). b , c , d Transduced BMMs were cultured with M-CSF (30 ng/mL) and the indicated doses of RANKL for 4 or 5 days. b Osteoclasts were visualized after tartrate-resistant acid phosphatase (TRAP) staining and, c the number of osteoclasts was counted. d TRAP activity was determined by using the cultured cell supernatant generated in ( b) . e Transduced BMMs were cultured in the presence of various concentrations of M-CSF. After 3 days, the MTS assay was performed, as described in the Materials and Methods section. f Transduced BMMs were cultured in osteoclastogenic media for the indicated times. Real-time PCR was performed to assess the gene expression of osteoclastogenic markers. All data are expressed as the mean ± SD. * P < 0.05 and ** P < 0.001 vs. the control (Con-sh)

    Article Snippet: The lentiviral constructs containing PLCβ4 small hairpin RNA (shRNA) or a non-specific shRNA control (Con-sh) were obtained from Sigma-Aldrich (St. Louis, MO, USA).

    Techniques: Transduction, shRNA, Expressing, Real-time Polymerase Chain Reaction, Cell Culture, Staining, Activity Assay, Generated, MTS Assay